Skip to main content
Addgene

pYea5.1_Notch1_sfGFP
(Plasmid #207801)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 207801 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGBKT7 DNA-BD Vector
  • Backbone manufacturer
    Clontech #630443
  • Backbone size w/o insert (bp) 6364
  • Total vector size (bp) 10111
  • Vector type
    Bacterial Expression, Yeast Expression
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Suc2SP-Notch1_100-sfGFP-GAL4 fusion protein
  • Species
    H. sapiens (human), S. cerevisiae (budding yeast), Synthetic
  • Insert Size (bp)
    3747
  • Promoter TEF
  • Tag / Fusion Protein
    • Strep-TagII (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (unknown if destroyed)
  • 3′ cloning site KpnI (unknown if destroyed)
  • 5′ sequencing primer AAAGGTTAGGATTTGCCACTGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYea5.1_Notch1_sfGFP was a gift from Dieter Langosch (Addgene plasmid # 207801 ; http://n2t.net/addgene:207801 ; RRID:Addgene_207801)
  • For your References section:

    Permissive Conformations of a Transmembrane Helix Allow Intramembrane Proteolysis by gamma-Secretase. Ortner M, Guschtschin-Schmidt N, Stelzer W, Muhle-Goll C, Langosch D. J Mol Biol. 2023 Aug 1;435(18):168218. doi: 10.1016/j.jmb.2023.168218. 10.1016/j.jmb.2023.168218 PubMed 37536392