pYea5.1_Notch1_sfGFP
(Plasmid
#207801)
-
PurposeYeast 2µ vector for expression of Suc2SP-Notch1_100-sfGFP-GAL4
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 207801 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGBKT7 DNA-BD Vector
-
Backbone manufacturerClontech #630443
- Backbone size w/o insert (bp) 6364
- Total vector size (bp) 10111
-
Vector typeBacterial Expression, Yeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSuc2SP-Notch1_100-sfGFP-GAL4 fusion protein
-
SpeciesH. sapiens (human), S. cerevisiae (budding yeast), Synthetic
-
Insert Size (bp)3747
- Promoter TEF
-
Tag
/ Fusion Protein
- Strep-TagII (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (unknown if destroyed)
- 3′ cloning site KpnI (unknown if destroyed)
- 5′ sequencing primer AAAGGTTAGGATTTGCCACTGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYea5.1_Notch1_sfGFP was a gift from Dieter Langosch (Addgene plasmid # 207801 ; http://n2t.net/addgene:207801 ; RRID:Addgene_207801) -
For your References section:
Permissive Conformations of a Transmembrane Helix Allow Intramembrane Proteolysis by gamma-Secretase. Ortner M, Guschtschin-Schmidt N, Stelzer W, Muhle-Goll C, Langosch D. J Mol Biol. 2023 Aug 1;435(18):168218. doi: 10.1016/j.jmb.2023.168218. 10.1016/j.jmb.2023.168218 PubMed 37536392