pYea5.1_Notch1_sfGFP
(Plasmid #207801)

• Purpose: Yeast 2µ vector for expression of Suc2SP-Notch1_100-sfGFP-GAL4
• Depositing Lab: Dieter Langosch
• Publication: Ortner et al J Mol Biol. 2023 Aug 1;435(18):168218. doi: 10.1016/j.jmb.2023.168218.

Backbone

• Vector backbone: pGBKT7 DNA-BD Vector
• Backbone manufacturer: Clontech #630443
• Backbone size w/o insert (bp): 6364
• Total vector size (bp): 10111
• Vector type: Bacterial Expression, Yeast Expression
• Selectable markers: TRP1

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Suc2SP-Notch1_100-sfGFP-GAL4 fusion protein
• Species: H. sapiens (human), S. cerevisiae (budding yeast), Synthetic
• Insert Size (bp): 3747
• Promoter: TEF
• Tag / Fusion Protein:
  • Strep-TagII (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (unknown if destroyed)
• 3′ cloning site: KpnI (unknown if destroyed)
• 5′ sequencing primer: AAAGGTTAGGATTTGCCACTGAGG

Resource Information

• Supplemental Documents:
  • 2198_pYea5.1_Notch1_100.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry