pTRE-BI-hGRAD
(Plasmid #207837)

• Purpose: Inducible hGRAD Plasmids for rapid depletion of GFP-tagged proteins in mammalian cells
• Depositing Lab: Michaela Mueller-McNicoll
• Publication: Arnold et al J Cell Biol. 2024 Feb 5;223(2):e202304030. doi: 10.1083/jcb.202304030. Epub 2023 Dec 18.

Backbone

• Vector backbone: VB190904-1039fwc
• Backbone manufacturer: VectorBuilder
• Backbone size w/o insert (bp): 6768
• Total vector size (bp): 8431
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Although the plasmid is expressed from a "high-copy" ORI, the amounts of plasmid recovered from conventional plasmid preparations are relatively low (possibly due to the size and/or complexity of the plasmid).
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: mCherry
• Insert Size (bp): 711
• Promoter: TRE3G BI promoter

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: SpeI (unknown if destroyed)
• 5′ sequencing primer: AACTCGAGTATGTCGAGG
• 3′ sequencing primer: TTTTGGCAGAGGGAAAAAGA

Gene/Insert 2

• Gene/Insert name: hFBXW11
• Alt name: F-box/WD repeat-containing protein 11 isoform B
• Species: H. sapiens (human)
• Insert Size (bp): 645
• Mutation: 215 amino acids of the full length protein
• Entrez Gene: FBXW11 (a.k.a. BTRC2, BTRCP2, FBW1B, FBXW1B, Fbw11, Hos, NEDJED)
• Promoter: TRE3G BI promoter

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CCTACCCTCGTAAACCGC
• 3′ sequencing primer: AAAGGACAGTGGGAGTGG

Gene/Insert 3

• Gene/Insert name: VHH-GFP4
• Alt name: GFP Nanobody
• Species: Synthetic
• Insert Size (bp): 342
• Promoter: TRE3G BI promoter

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CCTACCCTCGTAAACCGC
• 3′ sequencing primer: AAAGGACAGTGGGAGTGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry