Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTRE-BI-osTIR1
(Plasmid #207840)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 207840 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    VB190904-1039fwc
  • Backbone manufacturer
    VectorBuilder
  • Backbone size w/o insert (bp) 6768
  • Total vector size (bp) 9929
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Although the plasmid is expressed from a "high-copy" ORI, the amounts of plasmid recovered from conventional plasmid preparations are relatively low (possibly due to the size and/or complexity of the plasmid).
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    osTIR
  • Alt name
    rice transport inhibitor response 1 protein
  • Species
    Oryza sativa
  • Insert Size (bp)
    1722
  • Promoter TRE3G BI promoter

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGAGGCTAGTCTCGTGATC
  • 3′ sequencing primer AAGCGCATGAACTCCTTGATGATG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mCherry
  • Insert Size (bp)
    732
  • Promoter TRE3G BI promoter
  • Tag / Fusion Protein
    • weak NLS (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAGAGAATGTAAGGGACTCC
  • 3′ sequencing primer TTTTGGCAGAGGGAAAAAGA
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    mAID_-VHH-GFP4
  • Species
    A. thaliana (mustard weed), Synthetic
  • Insert Size (bp)
    711
  • Mutation
    All K mutated to R
  • Promoter TRE3G BI promoter
  • Tag / Fusion Protein
    • 3X HA-Tag (N terminal on insert)

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCTACCCTCGTAAACCGC
  • 3′ sequencing primer AAAGGACAGTGGGAGTGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    (Daniel et al., 2018)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTRE-BI-osTIR1 was a gift from Michaela Mueller-McNicoll (Addgene plasmid # 207840 ; http://n2t.net/addgene:207840 ; RRID:Addgene_207840)
  • For your References section:

    hGRAD: A versatile "one-fits-all" system to acutely deplete RNA binding proteins from condensates. Arnold B, Riegger RJ, Okuda EK, Sliskovic I, Keller M, Bakisoglu C, McNicoll F, Zarnack K, Muller-McNicoll M. J Cell Biol. 2024 Feb 5;223(2):e202304030. doi: 10.1083/jcb.202304030. Epub 2023 Dec 18. 10.1083/jcb.202304030 PubMed 38108808