RGB-S reporter
(Plasmid
#207841)
-
PurposeA three-colour stress biosensor for real time analysis of physiological stress, genotoxicity, and cytotoxicity of Escherichia coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 207841 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMK-RQ
-
Backbone manufacturerGeneArt® Gene Synthesis, ThermoFisher Scientific and IDT Inc.
- Backbone size w/o insert (bp) 4531
- Total vector size (bp) 5409
-
Modifications to backbonePsulA::GFPmut3b::terminator_1 and PosmY::mRFP1::terminator_2 were integrated into pMK-RQ by GeneArt, then integration of terminator_3::PgrpE::mTagBFP2::terminator_4
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameRpoH sensing construct
-
Alt namePgrpE::mTagBFP2
-
SpeciesSynthetic
-
Insert Size (bp)717
-
GenBank IDUYR58244.1
- Promoter grpE
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CCAGTGAGCGCGACGTAATA
- 3′ sequencing primer CGGCCACTCAACCCTATCTC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameSOS sensing construct
-
Alt namePsulA::GFPmut3b
-
SpeciesSynthetic
-
Insert Size (bp)720
-
GenBank IDAAB18957.1
- Promoter PsulA
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer synthesized on backbone
- 3′ sequencing primer - (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameRpoS sensing construct
-
Alt namePosmY::mRFP1
-
Insert Size (bp)681
-
GenBank IDCAH64892
- Promoter PosmY
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer synthesized on backbone
- 3′ sequencing primer - (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The submitted plasmid version has additional 111 bp (1181-1291 bp) in the plasmid backbone compared to the version in the publication. The deposited plasmid has been tested and experimentally validated entailing no impact on the biosensor function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RGB-S reporter was a gift from Christof Niemeyer (Addgene plasmid # 207841 ; http://n2t.net/addgene:207841 ; RRID:Addgene_207841) -
For your References section:
A three-colour stress biosensor reveals multimodal response in single cells and spatiotemporal dynamics of biofilms. Zoheir AE, Sobol MS, Meisch L, Ordonez-Rueda D, Kaster AK, Niemeyer CM, Rabe KS. NPJ Biofilms Microbiomes. 2023 Aug 21;9(1):57. doi: 10.1038/s41522-023-00424-1. 10.1038/s41522-023-00424-1 PubMed 37604827