pHLsec-dasTMPRSS2
(Plasmid
#207850)
-
PurposeExpresses directed activation strategy TMPRSS2 in mammalian cells, such as HEK293F- or CHO-cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 207850 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHL-sec
-
Backbone manufacturerEdith Yvonne Jones Lab
- Backbone size w/o insert (bp) 4656
- Total vector size (bp) 5808
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametransmembrane serine protease 2
-
Alt namePRSS10
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1152
-
Mutationdeleted amino acid 1-108, S251D R252D Q253D S254D R255D
-
GenBank ID7113
-
Entrez GeneTMPRSS2 (a.k.a. PRSS10)
- Promoter CAG
-
Tag
/ Fusion Protein
- AviTag, 8xHIS tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGGATCCTTCCCAGCCCTGGG
- 3′ sequencing primer TGAATTATCGCGATACTAGTCTCG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHLsec-dasTMPRSS2 was a gift from Ingrid De Meester (Addgene plasmid # 207850 ; http://n2t.net/addgene:207850 ; RRID:Addgene_207850) -
For your References section:
Human Transmembrane Serine Protease 2 (TMPRSS2) on Human Seminal Fluid Extracellular Vesicles Is Proteolytically Active. Verhulst E, De Bruyn M, Berckmans P, Sim Y, Augustyns K, Pintelon I, Berg M, Van Wielendaele P, Lambeir AM, Sterckx YG, Nelissen I, De Meester I. J Extracell Vesicles. 2025 Mar;14(3):e70061. doi: 10.1002/jev2.70061. 10.1002/jev2.70061 PubMed 40091430