Skip to main content
Addgene

pHLsec-dasTMPRSS2
(Plasmid #207850)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 207850 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHL-sec
  • Backbone manufacturer
    Edith Yvonne Jones Lab
  • Backbone size w/o insert (bp) 4656
  • Total vector size (bp) 5808
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    transmembrane serine protease 2
  • Alt name
    PRSS10
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1152
  • Mutation
    deleted amino acid 1-108, S251D R252D Q253D S254D R255D
  • GenBank ID
    7113
  • Entrez Gene
    TMPRSS2 (a.k.a. PRSS10)
  • Promoter CAG
  • Tag / Fusion Protein
    • AviTag, 8xHIS tag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGGATCCTTCCCAGCCCTGGG
  • 3′ sequencing primer TGAATTATCGCGATACTAGTCTCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHLsec-dasTMPRSS2 was a gift from Ingrid De Meester (Addgene plasmid # 207850 ; http://n2t.net/addgene:207850 ; RRID:Addgene_207850)
  • For your References section:

    Human Transmembrane Serine Protease 2 (TMPRSS2) on Human Seminal Fluid Extracellular Vesicles Is Proteolytically Active. Verhulst E, De Bruyn M, Berckmans P, Sim Y, Augustyns K, Pintelon I, Berg M, Van Wielendaele P, Lambeir AM, Sterckx YG, Nelissen I, De Meester I. J Extracell Vesicles. 2025 Mar;14(3):e70061. doi: 10.1002/jev2.70061. 10.1002/jev2.70061 PubMed 40091430