pTarget-Dual
(Plasmid
#207884)
-
PurposeCarries the cognate target sites for the homing endonucleases I-OnuI and I-GpeMI.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 207884 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepACYC184
-
Backbone manufacturerNew England Biolabs
- Backbone size w/o insert (bp) 3699
- Total vector size (bp) 3743
-
Modifications to backboneCmR swapped for KanR, p15A ori swapped for pBR322, inserted the I-OnuI and I-GpeMI target sites, Cen6-ArsH4-His3 included for yeast assemblies.
-
Vector typeBacterial Expression, Synthetic Biology
-
Selectable markersHIS3
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameI-OnuI target site
-
SpeciesO. novo-ulmi
-
Insert Size (bp)22
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer gaatagtgtatgcggcgac
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameI-GpeMI target site
-
SpeciesG. penicillata
-
Insert Size (bp)22
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer gatgacgagcgtaatggctg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The Edgell Lab uses EPI300 E. coli for transformation, but DH5alpha will also be fine.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTarget-Dual was a gift from David Edgell (Addgene plasmid # 207884 ; http://n2t.net/addgene:207884 ; RRID:Addgene_207884) -
For your References section:
Intein-based thermoregulated meganucleases for containment of genetic material. Foo GW, Leichthammer CD, Saita IM, Lukas ND, Batko IZ, Heinrichs DE, Edgell DR. Nucleic Acids Res. 2024 Feb 28;52(4):2066-2077. doi: 10.1093/nar/gkad1247. 10.1093/nar/gkad1247 PubMed 38180814