miR-206-1/miR-133b promoter GFP
(Plasmid
#20793)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 20793 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBSII SK+ modified to introduce GFP and more cloning sites
-
Backbone manufacturerBartel Lab
-
Vector typezebrafish expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemir-206-1/mir-133b
-
Alt namemiR-206
-
Alt namemiR-133
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)4500
-
Entrez Genemir206-1 (a.k.a. dre-mir-206-1)
-
Tag
/ Fusion Protein
- GFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ApaI (unknown if destroyed)
- 3′ cloning site SmaI (destroyed during cloning)
- 5′ sequencing primer CTGCCCCATTTAGACTCTTTCTTGACG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For polycistronic mir-206-1/mir-133b, we were not able to identify the transcriptional start precisely by 5′-RACE due to the repetitive sequence in this region. Analyses of EST clones (BM259633, CF999541, CF348604, DR729161) mapped the approximate start of the mir-206-1/mir-133b primary transcript to 1.4 kb from the mir-206 hairpin. A 4.5-kb upstream fragment that includes ∼0.9 kb of the primary transcript was amplified from genomic DNA using primers 3 and 4 (5'-CTGCCCCATTTAGACTCTTTCTTGACG-3' and 5'-CCAGAAGAACCCAGACGAAACCCAC-3'). The promoter fragment was fused to a GFP reporter gene. The miRNA promoter fusion was flanked by I-SceI meganuclease recognition sites to increase the efficiency of transgenensis.
Please note that Addgene's sequencing results show some differences from the published sequence. The depositing lab is aware of the differences.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
miR-206-1/miR-133b promoter GFP was a gift from David Bartel (Addgene plasmid # 20793 ; http://n2t.net/addgene:20793 ; RRID:Addgene_20793) -
For your References section:
Coherent but overlapping expression of microRNAs and their targets during vertebrate development. Shkumatava A, Stark A, Sive H, Bartel DP. Genes Dev. 2009 Feb 15. 23(4):466-81. 10.1101/gad.1745709 PubMed 19240133
Map uploaded by the depositor.