pSEVA23-GG
(Plasmid
#208013)
-
Purposefor cloning homology arms, with GFP as counter selection marker
-
Depositing Lab
-
Depositing OrganizationDanmarks Tekniske Universitet
Located in Denmark -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 208013 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 208013-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 208013-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepSEVA231
-
Backbone manufacturerSEVA collection
- Backbone size w/o insert (bp) 3123
- Total vector size (bp) 3995
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemsfGFP
-
Insert Size (bp)717
- Promoter 14G
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer agcggataacaatttcacacagga
- 3′ sequencing primer cgccagggttttcccagtcacgac
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.06.29.547033 for bioRxiv preprint.
DNA (Catalog # 208013-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 208013-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSEVA23-GG was a gift from Pablo Ivan Nikel (Addgene plasmid # 208013 ; http://n2t.net/addgene:208013 ; RRID:Addgene_208013) -
For your References section:
A SEVA-based, CRISPR-Cas3-assisted genome engineering approach for Pseudomonas with efficient vector curing. Lammens E-M, Volke DC, Schroven K, Voet M, Kerremans A, Lavigne R, Hendrix H. Microbiol Spectr. 2023 Nov 17:e0270723. doi: 10.1128/spectrum.02707-23. 10.1128/spectrum.02707-23 PubMed 37975669