Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSEVA23-GG
(Plasmid #208013)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 208013 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSEVA231
  • Backbone manufacturer
    SEVA collection
  • Backbone size w/o insert (bp) 3123
  • Total vector size (bp) 3995

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    msfGFP
  • Insert Size (bp)
    717
  • Promoter 14G

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer agcggataacaatttcacacagga
  • 3′ sequencing primer cgccagggttttcccagtcacgac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.06.29.547033 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSEVA23-GG was a gift from Pablo Ivan Nikel (Addgene plasmid # 208013 ; http://n2t.net/addgene:208013 ; RRID:Addgene_208013)
  • For your References section:

    A SEVA-based, CRISPR-Cas3-assisted genome engineering approach for Pseudomonas with efficient vector curing. Lammens E-M, Volke DC, Schroven K, Voet M, Kerremans A, Lavigne R, Hendrix H. Microbiol Spectr. 2023 Nov 17:e0270723. doi: 10.1128/spectrum.02707-23. 10.1128/spectrum.02707-23 PubMed 37975669