pLV_PGK_LTB4R(T308A)
(Plasmid
#208088)
-
PurposeMammalian expression of the human LTB4 receptor LTB4R with the T308A mutation.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 208088 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti 2nd gen
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLTB4R(T308A)
-
Alt nameLTB4R
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1059
-
MutationT308A
-
Entrez GeneLTB4R (a.k.a. BLT1, BLTR, CMKRL1, GPR16, LTB4R1, LTBR1, P2RY7, P2Y7)
- Promoter PGK
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tgttccgcattctgcaagc
- 3′ sequencing primer cctcacattgccaaaagacg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe wild-type LTB4R sequence was obtained from the Harvard plasmid repository (plasmid #HsCD00003892)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
5' Cloning Site: BamHI (not destroyed); 3' Cloning Site: NotI (not destroyed)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV_PGK_LTB4R(T308A) was a gift from Sean R Collins (Addgene plasmid # 208088 ; http://n2t.net/addgene:208088 ; RRID:Addgene_208088) -
For your References section:
Signaling dynamics distinguish high- and low-priority neutrophil chemoattractant receptors. Lundgren SM, Rocha-Gregg BL, Akdogan E, Mysore MN, Hayes S, Collins SR. Sci Signal. 2023 Oct 3;16(805):eadd1845. doi: 10.1126/scisignal.add1845. Epub 2023 Oct 3. 10.1126/scisignal.add1845 PubMed 37788324