Skip to main content

pLV_PGK_3xHA-LTB4R
(Plasmid #208091)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 208091 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti 2nd gen
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    3xHA-LTB4R
  • Alt name
    LTB4R
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1140
  • Mutation
    none
  • Entrez Gene
    LTB4R (a.k.a. BLT1, BLTR, CMKRL1, GPR16, LTB4R1, LTBR1, P2RY7, P2Y7)
  • Promoter PGK
  • Tag / Fusion Protein
    • 3xHA (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tgttccgcattctgcaagc
  • 3′ sequencing primer cctcacattgccaaaagacg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The wild-type LTB4R sequence was obtained from the Harvard plasmid repository (plasmid #HsCD00003892)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

5' Cloning Site: BamHI (not destroyed); 3' Cloning Site: NotI (not destroyed)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV_PGK_3xHA-LTB4R was a gift from Sean R Collins (Addgene plasmid # 208091 ; http://n2t.net/addgene:208091 ; RRID:Addgene_208091)
  • For your References section:

    Signaling dynamics distinguish high- and low-priority neutrophil chemoattractant receptors. Lundgren SM, Rocha-Gregg BL, Akdogan E, Mysore MN, Hayes S, Collins SR. Sci Signal. 2023 Oct 3;16(805):eadd1845. doi: 10.1126/scisignal.add1845. Epub 2023 Oct 3. 10.1126/scisignal.add1845 PubMed 37788324