Skip to main content

1529_pAAV-CB-FKBP12-BirA-HA
(Plasmid #208200)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 208200 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEMBL8
  • Backbone size w/o insert (bp) 5769
  • Total vector size (bp) 6093
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Confirm ITRs after propagation by restriction digest with XmaI, sequencing
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Fkbp12
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Fkbp1a (a.k.a. FKBP12, Fkbp, Fkbp1)
  • Promoter Chicken beta-actin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer gctcctcagtggatgttgcctttac
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Dr. Pumin Zhang created the targeting vectors. Dr. Jin Hong synthesized and cloned the plasmid.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    1529_pAAV-CB-FKBP12-BirA-HA was a gift from Susan Hamilton (Addgene plasmid # 208200 ; http://n2t.net/addgene:208200 ; RRID:Addgene_208200)
  • For your References section:

    Speg interactions that regulate the stability of excitation-contraction coupling protein complexes in triads and dyads. Lee CS, Jung SY, Yee RSZ, Agha NH, Hong J, Chang T, Babcock LW, Fleischman JD, Clayton B, Hanna AD, Ward CS, Lanza D, Hurley AE, Zhang P, Wehrens XHT, Lagor WR, Rodney GG, Hamilton SL. Commun Biol. 2023 Sep 14;6(1):942. doi: 10.1038/s42003-023-05330-y. 10.1038/s42003-023-05330-y PubMed 37709832