Skip to main content

RGG-BcLOV-mCh-EGFR
(Plasmid #208280)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 208280 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PHR
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    RGG-BcLOV-mCh-EGFR
  • Species
    H. sapiens (human); Botrytis cinerea
  • Mutation
    H225N in mCherry- please see depositor comment
  • Promoter pCMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGCACCAAAATCAACGGGACTTTCC
  • 3′ sequencing primer tgacaacgggccacaactcctc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Depositor confirms H225N mutation in mCherry does not affect fluorescence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RGG-BcLOV-mCh-EGFR was a gift from Lukasz Bugaj (Addgene plasmid # 208280 ; http://n2t.net/addgene:208280 ; RRID:Addgene_208280)
  • For your References section:

    Optogenetic clustering and membrane translocation of the BcLOV4 photoreceptor. Pal AA, Benman W, Mumford TR, Huang Z, Chow BY, Bugaj LJ. Proc Natl Acad Sci U S A. 2023 Aug 8;120(32):e2221615120. doi: 10.1073/pnas.2221615120. Epub 2023 Aug 1. 10.1073/pnas.2221615120 PubMed 37527339