pLenti-Cas9.mCherry
(Plasmid
#208342)
-
PurposeLentivirus with EF1a driven Cas9 linked (P2A) to mCherry.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 208342 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti-Cas9.mCherry
- Total vector size (bp) 12770
-
Modifications to backboneDeleted U6 promoter and sgRNA sequence from LentiCRISPRv2-mCherry (Addgene 99154) leaving Cas9 and mCherry. Digested backbone with KpnI and EcoRI and replaced region using assembly cloning with the following oligo: gcagagatccagtttggttaattaaggtacaattcgctagctaggtcttgaaaggagtgg
-
Vector typeLentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameCas9
-
Alt nameCsn1
-
SpeciesS. pyogenes
-
Insert Size (bp)4104
-
GenBank ID69900935
- Promoter EF-1a
-
Tag
/ Fusion Protein
- nuclear localization sequence (NLS) and FLAG tag (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer cacatcgcccacagtcc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemCherry
-
SpeciesSynthetic
-
Insert Size (bp)708
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
7.9kb LTR-to-LTR
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-Cas9.mCherry was a gift from Peter S Nelson (Addgene plasmid # 208342 ; http://n2t.net/addgene:208342 ; RRID:Addgene_208342) -
For your References section:
Molecular consequences of acute versus chronic CDK12 loss in prostate carcinoma nominates distinct therapeutic strategies. Frank S, Persse T, Coleman I, Bankhead III A, Li D, De-Sarkar N, Wilson D, Rudoy D, Vashisth M, Galipeau P, Yang M, Hanratty B, Dumpit R, Morrissey C, Corey E, Montgomery RB, Haffner MC, Pritchard CC, Vasioukhin V, Ha G, Nelson PS. eLife 2025 10.7554/eLife.100081.2