Skip to main content

pLCV2-AAVS1(hU6-sg1-mU6-sg2)-Blast
(Plasmid #208343)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 208343 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lentiCRISPR v2-Blast
  • Backbone manufacturer
    Addgene 83480
  • Backbone size w/o insert (bp) 14684
  • Total vector size (bp) 13280
  • Modifications to backbone
    Cloned in two sgRNAs, one with a hU6 promoter and one with a mU6 promoter.
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    AAVS1
  • gRNA/shRNA sequence
    ACTGTTGACGGCGGCGATGT; GCTGATACCGTCGGCGTTGG
  • Species
    H. sapiens (human)
  • Entrez Gene
    AAVS1 (a.k.a. AAV)
  • Promoter hU6, mU6

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer gagggcctatttcccatgatt
  • 3′ sequencing primer ctgtgttctggcggcaa
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

8.4kb LTR-to-LTR

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLCV2-AAVS1(hU6-sg1-mU6-sg2)-Blast was a gift from Peter S Nelson (Addgene plasmid # 208343 ; http://n2t.net/addgene:208343 ; RRID:Addgene_208343)
  • For your References section:

    Molecular consequences of acute versus chronic CDK12 loss in prostate carcinoma nominates distinct therapeutic strategies. Frank S, Persse T, Coleman I, Bankhead III A, Li D, De-Sarkar N, Wilson D, Rudoy D, Vashisth M, Galipeau P, Yang M, Hanratty B, Dumpit R, Morrissey C, Corey E, Montgomery RB, Haffner MC, Pritchard CC, Vasioukhin V, Ha G, Nelson PS. eLife 2025 10.7554/eLife.100081.2