pCR8-CDK12(sgR)
(Plasmid
#208346)
-
PurposeGateway cloning entry vector with CDK12 with sgRNA resistant silent mutations. Must be recombined into a DEST vector for expression.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 208346 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCR8
-
Backbone manufacturerInvitrogen (K250020)
- Backbone size w/o insert (bp) 2790
- Total vector size (bp) 7306
-
Modifications to backboneSilent mutations were made on pCR8-CDK12 (Addgene 208347) to confer resistance to the following CDK12 targeting sgRNAs: TGGCCTTCAAACTAGACCGA and GACAAACAGAAAGCGACTGG.
-
Vector typeGateway: ENTRY vector
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namecyclin dependent kinase 12
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4473
-
MutationSilent mutations in A88, K90, D92, R94, T715, S717, D718
-
Entrez GeneCDK12 (a.k.a. CRK7, CRKR, CRKRS)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCR8-CDK12(sgR) was a gift from Peter S Nelson (Addgene plasmid # 208346 ; http://n2t.net/addgene:208346 ; RRID:Addgene_208346) -
For your References section:
Molecular consequences of acute versus chronic CDK12 loss in prostate carcinoma nominates distinct therapeutic strategies. Frank S, Persse T, Coleman I, Bankhead III A, Li D, De-Sarkar N, Wilson D, Rudoy D, Vashisth M, Galipeau P, Yang M, Hanratty B, Dumpit R, Morrissey C, Corey E, Montgomery RB, Haffner MC, Pritchard CC, Vasioukhin V, Ha G, Nelson PS. eLife 2025 10.7554/eLife.100081.2