Skip to main content
Addgene
Open Menu

pCR8-CDK12(sgR)
(Plasmid #208346)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 208346 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pCR8
  • Backbone manufacturer
    Invitrogen (K250020)
  • Backbone size w/o insert (bp) 2790
  • Total vector size (bp) 7306
  • Modifications to backbone
    Silent mutations were made on pCR8-CDK12 (Addgene 208347) to confer resistance to the following CDK12 targeting sgRNAs: TGGCCTTCAAACTAGACCGA and GACAAACAGAAAGCGACTGG.
  • Vector type
    Gateway: ENTRY vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    cyclin dependent kinase 12
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4473
  • Mutation
    Silent mutations in A88, K90, D92, R94, T715, S717, D718
  • Entrez Gene
    CDK12 (a.k.a. CRK7, CRKR, CRKRS)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCR8-CDK12(sgR) was a gift from Peter S Nelson (Addgene plasmid # 208346 ; http://n2t.net/addgene:208346 ; RRID:Addgene_208346)

  • For your References section:

    Molecular consequences of acute versus chronic CDK12 loss in prostate carcinoma nominates distinct therapeutic strategies. Frank S, Persse T, Coleman I, Bankhead III A, Li D, De-Sarkar N, Wilson D, Rudoy D, Vashisth M, Galipeau P, Yang M, Hanratty B, Dumpit R, Morrissey C, Corey E, Montgomery RB, Haffner MC, Pritchard CC, Vasioukhin V, Ha G, Nelson PS. eLife 2025 10.7554/eLife.100081.2
Related items: