pLCV2-CDK13(hU6-sg2-mU6-sg3)-Blast
(Plasmid
#208348)
-
PurposepLentiCRISPRv2-Blast backbone with two separate sgRNAs against CDK13
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 208348 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonelentiCRISPR v2-Blast
-
Backbone manufacturerPlasmid #83480
- Backbone size w/o insert (bp) 14684
- Total vector size (bp) 13280
-
Modifications to backboneCloned in two sgRNAs, one with a hU6 promoter and one with a mU6 promoter.
-
Vector typeLentiviral, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namecyclin dependent kinase 13
-
gRNA/shRNA sequenceACGACAGCCCGGTGTCCCAC; AGTTGGAGGAACGCCGCAAG
-
SpeciesH. sapiens (human)
-
GenBank ID
-
Entrez GeneCDK13 (a.k.a. CDC2L, CDC2L5, CHDFIDD, CHED, hCDK13)
- Promoter hU6, mU6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gagggcctatttcccatgatt
- 3′ sequencing primer ctgtgttctggcggcaa
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
8.4kb LTR-to-LTR
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLCV2-CDK13(hU6-sg2-mU6-sg3)-Blast was a gift from Peter S Nelson (Addgene plasmid # 208348 ; http://n2t.net/addgene:208348 ; RRID:Addgene_208348) -
For your References section:
Molecular consequences of acute versus chronic CDK12 loss in prostate carcinoma nominates distinct therapeutic strategies. Frank S, Persse T, Coleman I, Bankhead III A, Li D, De-Sarkar N, Wilson D, Rudoy D, Vashisth M, Galipeau P, Yang M, Hanratty B, Dumpit R, Morrissey C, Corey E, Montgomery RB, Haffner MC, Pritchard CC, Vasioukhin V, Ha G, Nelson PS. eLife 2025 10.7554/eLife.100081.2