pLenti-sgStuffer-mCherry-Puro
(Plasmid
#208350)
-
Purpose(Empty Backbone) Lentivirus sgRNA backbone with mCherry and PuroR. Compatible with golden gate cloning (Esp3i/BsmBI)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 208350 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonelentiCRISPR v2
- Backbone size (bp) 7615
-
Modifications to backboneCas9 and BlastR were excised and mCherry was added via a combination of restriction and assembly cloning using lentiCRISPRv2 (Addgene 52961) as the starting backbone.
-
Vector typeLentiviral, CRISPR
- Promoter hU6
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer gagggcctatttcccatgatt
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Construct was cloned by Mr. Phillip D. Corrin and Dr. Michael D. Nyquist. 4.7kb LTR-to-LTR with sgRNA inserted.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-sgStuffer-mCherry-Puro was a gift from Peter S Nelson (Addgene plasmid # 208350 ; http://n2t.net/addgene:208350 ; RRID:Addgene_208350) -
For your References section:
Molecular consequences of acute versus chronic CDK12 loss in prostate carcinoma nominates distinct therapeutic strategies. Frank S, Persse T, Coleman I, Bankhead III A, Li D, De-Sarkar N, Wilson D, Rudoy D, Vashisth M, Galipeau P, Yang M, Hanratty B, Dumpit R, Morrissey C, Corey E, Montgomery RB, Haffner MC, Pritchard CC, Vasioukhin V, Ha G, Nelson PS. eLife 2025 10.7554/eLife.100081.2