pEGFP-Sec22b-shR
(Plasmid
#208358)
-
PurposeMammalian expression of fluorescent N-terminally tagged shRNA resistant Sec22b
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 208358 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClonetech
- Backbone size w/o insert (bp) 3969
- Total vector size (bp) 5373
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSec22b
-
Alt nameERS24
-
Alt nameERS-24
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1404
-
Mutationfour silent mutations introduced to render shRNA resistant
-
GenBank IDNM_001025686
-
Entrez GeneSec22b (a.k.a. Sec22l1)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GTCCTGCTGGAGTTCGTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThierry Galli, INSERM Paris
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Original plasmid was generated in the laboratory of Dr. Thierry Galli, INSERM Paris (Ref: Petkovic, M., Jemaiel, A., Daste, F. et al. Nat Cell Biol 16, 434–444 (2014). https://doi.org/10.1038/ncb2937) It was cloned into EcoRI and KpnI sites in the pEGFP-C1 vector (Clontech) from cDNA. The plasmid here was generated by site directed mutagenesis using the pEGFP-Sec22b construct as a template.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-Sec22b-shR was a gift from Paula Nunes-Hasler (Addgene plasmid # 208358 ; http://n2t.net/addgene:208358 ; RRID:Addgene_208358) -
For your References section:
Sec22b regulates phagosome maturation by promoting ORP8-mediated lipid exchange at endoplasmic reticulum-phagosome contact sites. Criado Santos N, Bouvet S, Cruz Cobo M, Mandavit M, Bermont F, Castelbou C, Mansour F, Azam M, Giordano F, Nunes-Hasler P. Commun Biol. 2023 Oct 4;6(1):1008. doi: 10.1038/s42003-023-05382-0. 10.1038/s42003-023-05382-0 PubMed 37794132