Skip to main content

pEGFP-Sec22b-shR
(Plasmid #208358)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 208358 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clonetech
  • Backbone size w/o insert (bp) 3969
  • Total vector size (bp) 5373
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sec22b
  • Alt name
    ERS24
  • Alt name
    ERS-24
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    1404
  • Mutation
    four silent mutations introduced to render shRNA resistant
  • GenBank ID
    NM_001025686
  • Entrez Gene
    Sec22b (a.k.a. Sec22l1)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GTCCTGCTGGAGTTCGTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Thierry Galli, INSERM Paris

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Original plasmid was generated in the laboratory of Dr. Thierry Galli, INSERM Paris (Ref: Petkovic, M., Jemaiel, A., Daste, F. et al. Nat Cell Biol 16, 434–444 (2014). https://doi.org/10.1038/ncb2937) It was cloned into EcoRI and KpnI sites in the pEGFP-C1 vector (Clontech) from cDNA. The plasmid here was generated by site directed mutagenesis using the pEGFP-Sec22b construct as a template.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-Sec22b-shR was a gift from Paula Nunes-Hasler (Addgene plasmid # 208358 ; http://n2t.net/addgene:208358 ; RRID:Addgene_208358)
  • For your References section:

    Sec22b regulates phagosome maturation by promoting ORP8-mediated lipid exchange at endoplasmic reticulum-phagosome contact sites. Criado Santos N, Bouvet S, Cruz Cobo M, Mandavit M, Bermont F, Castelbou C, Mansour F, Azam M, Giordano F, Nunes-Hasler P. Commun Biol. 2023 Oct 4;6(1):1008. doi: 10.1038/s42003-023-05382-0. 10.1038/s42003-023-05382-0 PubMed 37794132