pEGFP-ORP8-H514A-H515A
(Plasmid
#208360)
-
PurposeMammalian expression of fluorescent N-terminally tagged H514A-H515A mutant of ORP8
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 208360 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3975
- Total vector size (bp) 7251
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameORP8
-
Alt nameOSBPL8
-
Alt nameORP8S
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3276
-
MutationH514A-H515A
-
GenBank IDNM_001319652
-
Entrez GeneOSBPL8 (a.k.a. MST120, MSTP120, ORP8, OSBP10)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site ApaI (not destroyed)
- 5′ sequencing primer GTCCTGCTGGAGTTCGTG
- 3′ sequencing primer CAGCCATCTCTTAGTCCAGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byFrancesca Giordano
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Original plasmid was generated in the laboratory of co-author Dr. Francesca Giordano, INSERM Paris-Saclay (Ref: Galmes et al. 2016 EMBO Rep. 2016 Jun; 17(6): 800–810. doi: 10.15252/embr.201541108). It was cloned into BglII and ApaI sites in the pEGFP-C1 vector (Clontech) from cDNA. The plasmid here was generated by site directed mutagenesis using the pEGFP-ORP8 construct as a template.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-ORP8-H514A-H515A was a gift from Paula Nunes-Hasler (Addgene plasmid # 208360 ; http://n2t.net/addgene:208360 ; RRID:Addgene_208360) -
For your References section:
Sec22b regulates phagosome maturation by promoting ORP8-mediated lipid exchange at endoplasmic reticulum-phagosome contact sites. Criado Santos N, Bouvet S, Cruz Cobo M, Mandavit M, Bermont F, Castelbou C, Mansour F, Azam M, Giordano F, Nunes-Hasler P. Commun Biol. 2023 Oct 4;6(1):1008. doi: 10.1038/s42003-023-05382-0. 10.1038/s42003-023-05382-0 PubMed 37794132