Skip to main content

pEGFP-ORP8-H514A-H515A
(Plasmid #208360)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 208360 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3975
  • Total vector size (bp) 7251
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ORP8
  • Alt name
    OSBPL8
  • Alt name
    ORP8S
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3276
  • Mutation
    H514A-H515A
  • GenBank ID
    NM_001319652
  • Entrez Gene
    OSBPL8 (a.k.a. MST120, MSTP120, ORP8, OSBP10)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site ApaI (not destroyed)
  • 5′ sequencing primer GTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer CAGCCATCTCTTAGTCCAGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Francesca Giordano

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Original plasmid was generated in the laboratory of co-author Dr. Francesca Giordano, INSERM Paris-Saclay (Ref: Galmes et al. 2016 EMBO Rep. 2016 Jun; 17(6): 800–810. doi: 10.15252/embr.201541108). It was cloned into BglII and ApaI sites in the pEGFP-C1 vector (Clontech) from cDNA. The plasmid here was generated by site directed mutagenesis using the pEGFP-ORP8 construct as a template.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-ORP8-H514A-H515A was a gift from Paula Nunes-Hasler (Addgene plasmid # 208360 ; http://n2t.net/addgene:208360 ; RRID:Addgene_208360)
  • For your References section:

    Sec22b regulates phagosome maturation by promoting ORP8-mediated lipid exchange at endoplasmic reticulum-phagosome contact sites. Criado Santos N, Bouvet S, Cruz Cobo M, Mandavit M, Bermont F, Castelbou C, Mansour F, Azam M, Giordano F, Nunes-Hasler P. Commun Biol. 2023 Oct 4;6(1):1008. doi: 10.1038/s42003-023-05382-0. 10.1038/s42003-023-05382-0 PubMed 37794132