pLenti gRNA KO OCLNx2 spCas9-T2A-Crimson-P2A-puro
(Plasmid
#208398)
-
Purposecodes for 2 gRNA-TracrRNA targeting human OCLN, Cas9, E2-Crimson fluorescent protein and puromycin resistance
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 208398 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti spCas9 T2A E2-Crimson P2A puro
- Total vector size (bp) 14154
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin, Zeocin ; fluorescent E2-Crimson
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehU6-gRNA and hH1-gRNA targeting OCLN gene
-
gRNA/shRNA sequenceGGCCTCTTGAAAGTCCACCT and TGTCATCCAGGCCTCTTGAA
-
SpeciesH. sapiens (human)
-
GenBank ID100506658
-
Entrez GeneOCLN (a.k.a. BLCPMG, PPP1R115, PTORCH1)
-
Tag
/ Fusion Protein
- E2-Crimson (C terminal on backbone)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.07.11.548555v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti gRNA KO OCLNx2 spCas9-T2A-Crimson-P2A-puro was a gift from Raphael Gaudin (Addgene plasmid # 208398 ; http://n2t.net/addgene:208398 ; RRID:Addgene_208398) -
For your References section:
LC3B conjugation machinery promotes autophagy-independent HIV-1 entry in CD4(+) T lymphocytes. Pradel B, Cantaloube G, Villares M, Deffieu MS, Robert-Hebmann V, Lucansky V, Faure M, Chazal N, Gaudin R, Espert L. Autophagy. 2024 Aug;20(8):1825-1836. doi: 10.1080/15548627.2024.2338573. Epub 2024 Apr 7. 10.1080/15548627.2024.2338573 PubMed 38566318