FUCRW-DEST
(Plasmid
#208409)
-
Purpose(Empty Backbone) Lentivirus compatible with LR Gateway cloning for UBC-driven gene expression with CMV-RFP in backbone
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 208409 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneFUCGW-DEST
- Backbone size (bp) 12303
-
Modifications to backbonemRFP1 was cloned in to replace EGFP in FUCGW-DEST.
-
Vector typeLentiviral ; Gateway: DEST vector
- Promoter UBC
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberUnknown
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer tgaagctccggttttgaact
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
FUCRW-DEST construct was cloned by Dr. Michael D. Nyquist.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FUCRW-DEST was a gift from Peter S Nelson (Addgene plasmid # 208409 ; http://n2t.net/addgene:208409 ; RRID:Addgene_208409) -
For your References section:
Molecular consequences of acute versus chronic CDK12 loss in prostate carcinoma nominates distinct therapeutic strategies. Frank S, Persse T, Coleman I, Bankhead III A, Li D, De-Sarkar N, Wilson D, Rudoy D, Vashisth M, Galipeau P, Yang M, Hanratty B, Dumpit R, Morrissey C, Corey E, Montgomery RB, Haffner MC, Pritchard CC, Vasioukhin V, Ha G, Nelson PS. eLife 2025 10.7554/eLife.100081.2