pKLV2-U6gRNA5(hRNF31_2b)-PGKpuro2ABFP-W
(Plasmid
#208415)
-
PurposeLentiviral gRNA plasmid targeting human RNF31 gene, co-expression of BFP tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 208415 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W
- Backbone size w/o insert (bp) 8648
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin ; BFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRNF31
-
gRNA/shRNA sequenceGTGACACCACGCCAGTACCG
-
SpeciesH. sapiens (human)
-
MutationN/A
-
Entrez GeneRNF31 (a.k.a. HOIP, IMD115, Paul, ZIBRA)
- Promoter human U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer AGATAATTAGAATTAATTTGACTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Used BbsI enzyme to clone in gRNA targeting gene of interest.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKLV2-U6gRNA5(hRNF31_2b)-PGKpuro2ABFP-W was a gift from Sok Ching Cheong (Addgene plasmid # 208415 ; http://n2t.net/addgene:208415 ; RRID:Addgene_208415) -
For your References section:
High TNF and NF-kappaB Pathway Dependency Are Associated with AZD5582 Sensitivity in OSCC via CASP8-Dependent Apoptosis. Chai AWY, Tan YH, Ooi S, Yee PS, Yee SM, Lightfoot H, Barthorpe S, Garnett MJ, Cheong SC. Cancer Res Commun. 2024 Nov 1;4(11):2919-2932. doi: 10.1158/2767-9764.CRC-24-0136. 10.1158/2767-9764.CRC-24-0136 PubMed 39360810