Skip to main content

pKLV2-U6gRNA5(hRIPK3_1k)-PGKpuro2ABFP-W
(Plasmid #208424)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 208424 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W
  • Backbone size w/o insert (bp) 8648
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin ; BFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    RIPK3
  • gRNA/shRNA sequence
    GAATTCGTGCTGCGCCTAGA
  • Species
    H. sapiens (human)
  • Mutation
    N/A
  • Entrez Gene
    Ripk3 (a.k.a. 2610528K09Rik, Rip3)
  • Promoter human U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer AGATAATTAGAATTAATTTGACTG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Used BbsI enzyme to clone in gRNA targeting gene of interest.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKLV2-U6gRNA5(hRIPK3_1k)-PGKpuro2ABFP-W was a gift from Sok Ching Cheong (Addgene plasmid # 208424 ; http://n2t.net/addgene:208424 ; RRID:Addgene_208424)
  • For your References section:

    High TNF and NF-kappaB Pathway Dependency Are Associated with AZD5582 Sensitivity in OSCC via CASP8-Dependent Apoptosis. Chai AWY, Tan YH, Ooi S, Yee PS, Yee SM, Lightfoot H, Barthorpe S, Garnett MJ, Cheong SC. Cancer Res Commun. 2024 Nov 1;4(11):2919-2932. doi: 10.1158/2767-9764.CRC-24-0136. 10.1158/2767-9764.CRC-24-0136 PubMed 39360810