Skip to main content

pKLV2-U6gRNA5(hADAR1_1k)-PGKpuro2ABFP-W
(Plasmid #208433)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 208433 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W
  • Backbone size w/o insert (bp) 8648
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin ; BFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ADAR1
  • gRNA/shRNA sequence
    GTATTCTAACAGCCCGCTGA
  • Species
    H. sapiens (human)
  • Mutation
    N/A
  • Entrez Gene
    ADAR (a.k.a. ADAR1, AGS6, DRADA, DSH, DSRAD, G1P1, IFI-4, IFI4, K88DSRBP, P136)
  • Promoter human U7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer AGATAATTAGAATTAATTTGACTG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Used BbsI enzyme to clone in gRNA targeting gene of interest.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKLV2-U6gRNA5(hADAR1_1k)-PGKpuro2ABFP-W was a gift from Sok Ching Cheong (Addgene plasmid # 208433 ; http://n2t.net/addgene:208433 ; RRID:Addgene_208433)
  • For your References section:

    Interferon-Inducible ADAR1 p150 Is Essential for the Survival of Oral Squamous Cell Carcinoma. Yee PS, Chai AWY, Yee SM, Ooi S, Tan YH, Garnett MJ, Ng SK, Cheong SC. Mol Carcinog. 2025 Jun;64(6):1066-1077. doi: 10.1002/mc.23910. Epub 2025 Mar 26. 10.1002/mc.23910 PubMed 40135601