pKLV2-U6gRNA5(hMDA5_2g)-PGKpuro2AmCherry-W
(Plasmid
#208436)
-
PurposeLentiviral gRNA plasmid targeting human MDA5 gene, co-expression of mCherry tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 208436 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepKLV2-U6gRNA5(BbsI)-PGKpuro2AmCherry-W
- Backbone size w/o insert (bp) 8657
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin ; mCherry
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMDA5
-
gRNA/shRNA sequenceGGGACTGAGGAATCAGCACG
-
SpeciesH. sapiens (human)
-
MutationN/A
-
Entrez GeneIFIH1 (a.k.a. AGS7, Hlcd, IDDM19, IMD95, MDA-5, MDA5, RLR-2, SGMRT1)
- Promoter human U10
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer AGATAATTAGAATTAATTTGACTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Used BbsI enzyme to clone in gRNA targeting gene of interest.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKLV2-U6gRNA5(hMDA5_2g)-PGKpuro2AmCherry-W was a gift from Sok Ching Cheong (Addgene plasmid # 208436 ; http://n2t.net/addgene:208436 ; RRID:Addgene_208436) -
For your References section:
Interferon-Inducible ADAR1 p150 Is Essential for the Survival of Oral Squamous Cell Carcinoma. Yee PS, Chai AWY, Yee SM, Ooi S, Tan YH, Garnett MJ, Ng SK, Cheong SC. Mol Carcinog. 2025 Jun;64(6):1066-1077. doi: 10.1002/mc.23910. Epub 2025 Mar 26. 10.1002/mc.23910 PubMed 40135601