CMV-SynCas.v39 mammalian expression
(Plasmid
#208592)
-
PurposeExpression of SynCas.v39 for analysis of RNA knockdown
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 208592 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC
- Backbone size w/o insert (bp) 3368
- Total vector size (bp) 7127
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSynCas.v39
-
SpeciesSynthetic
-
Insert Size (bp)3759
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctggtttagtgaaccgtcag
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.02.23.581838 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-SynCas.v39 mammalian expression was a gift from Omar Akbari (Addgene plasmid # 208592 ; http://n2t.net/addgene:208592 ; RRID:Addgene_208592) -
For your References section:
Synthetic Type III-E CRISPR-Cas Effectors for Programmable RNA-targeting. Brogan DJ, Lin CP, Benetta ED, Wang T, Chen F, Li H, Lin C, Komives EA, Akbari OS. J Mol Biol. 2026 Jan 15;438(2):169566. doi: 10.1016/j.jmb.2025.169566. Epub 2025 Nov 27. 10.1016/j.jmb.2025.169566 PubMed 41317788