T7-RBS-6xHis-SUMO-dSynCas.v12 bacteria
(Plasmid
#208597)
-
PurposeProduction and purification of catalytically inactive SynCas.v12
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 208597 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET
- Backbone size w/o insert (bp) 5253
- Total vector size (bp) 9534
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedSynCas.v12
-
SpeciesSynthetic
-
Insert Size (bp)4281
- Promoter T7
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gtgagcggataacaattccc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.02.23.581838 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
T7-RBS-6xHis-SUMO-dSynCas.v12 bacteria was a gift from Omar Akbari (Addgene plasmid # 208597 ; http://n2t.net/addgene:208597 ; RRID:Addgene_208597) -
For your References section:
Synthetic Type III-E CRISPR-Cas Effectors for Programmable RNA-targeting. Brogan DJ, Lin CP, Benetta ED, Wang T, Chen F, Li H, Lin C, Komives EA, Akbari OS. J Mol Biol. 2026 Jan 15;438(2):169566. doi: 10.1016/j.jmb.2025.169566. Epub 2025 Nov 27. 10.1016/j.jmb.2025.169566 PubMed 41317788