pRSFDuet1_CylLL_CylM
(Plasmid #208759)

• Purpose: Expresses modified cytolysin L (mCylLL) in E. coli
• Depositing Lab: Wilfred van der Donk
• Publication: Luo et al Anal Chem. 2024 Jan 30;96(4):1767-1773. doi: 10.1021/acs.analchem.3c04958. Epub 2024 Jan 17.

Backbone

• Vector backbone: pRSFDuet1
• Total vector size (bp): 6937
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: CylLL
• Alt name: Cytolysin L
• Species: Synthetic
• Insert Size (bp): 237
• Promoter: T7
• Tag / Fusion Protein:
  • Hisx6 Tag (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: cttatgcgactcctgcattaggaa

Gene/Insert 2

• Gene/Insert name: CylLM
• Alt name: Lanthionine synthetase CylLM
• Species: Synthetic
• Insert Size (bp): 2911
• Promoter: T7

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (unknown if destroyed)
• 3′ cloning site: KpnI (unknown if destroyed)
• 5′ sequencing primer: ttgtacacggccgcataatc
• 3′ sequencing primer: gctagttattgctcagcgg

Resource Information

• Supplemental Documents:
  • pRSFDuet1_CylLL_CylM.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2023.10.26.564210v2 for bioRxiv preprint.