Skip to main content

pET21a-C2m2-mKate
(Plasmid #208765)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 208765 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET21a(+)
  • Backbone manufacturer
    EMD Biosciences
  • Backbone size w/o insert (bp) 5365
  • Total vector size (bp) 6624
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    C2m2-mKate
  • Alt name
    C2 domain
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1259
  • Mutation
    Mutated 24 and 45 lysine to asparagine in C2 domain (K24N, K45N), disabling the probe binding to phosphatidylserine
  • GenBank ID
    17304
  • Entrez Gene
    Mfge8 (a.k.a. MFG-E8, MP47, Mfgm, P47, SED1, lactadherin)
  • Promoter T7 promoter
  • Tag / Fusion Protein
    • mKate (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CGGTTGGGAATGTAATTCAG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET21a-C2m2-mKate was a gift from Urte Neniskyte (Addgene plasmid # 208765 ; http://n2t.net/addgene:208765 ; RRID:Addgene_208765)
  • For your References section:

    Genetically encoded phosphatidylserine biosensor for in vitro, ex vivo and in vivo labelling. Dirvelyte E, Bujanauskiene D, Jankaityte E, Daugelaviciene N, Kisieliute U, Nagula I, Budvytyte R, Neniskyte U. Cell Mol Biol Lett. 2023 Jul 27;28(1):59. doi: 10.1186/s11658-023-00472-7. 10.1186/s11658-023-00472-7 PubMed 37501184