Skip to main content

pAAV-C2m2-SNAP
(Plasmid #208791)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 208791 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-GFAP-mKate2.5f
  • Backbone manufacturer
    Viviana Gradinaru
  • Backbone size w/o insert (bp) 4496
  • Total vector size (bp) 5699
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    C2m2-SNAP
  • Alt name
    C2 domain
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1203
  • Mutation
    Mutated 24 and 45 lysine to asparagine in C2 domain (K24N, K45N), disabling the probe binding to phosphatidylserine
  • GenBank ID
    17304
  • Entrez Gene
    Mfge8 (a.k.a. MFG-E8, MP47, Mfgm, P47, SED1, lactadherin)
  • Promoter GFAP promoter
  • Tag / Fusion Protein
    • SNAP-tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AflII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GAAGGTCTGAAGAGTTTACTCC
  • 3′ sequencing primer AATGAAAGCCATACGGGAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: The plasmid contains a 22bp deletion and three A/T mixed bases in the 5' ITR. The plasmid was successfully used for AAV packaging and expression in cells and tissues by the depositing lab. These discrepancies are not expected to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-C2m2-SNAP was a gift from Urte Neniskyte (Addgene plasmid # 208791 ; http://n2t.net/addgene:208791 ; RRID:Addgene_208791)
  • For your References section:

    Genetically encoded phosphatidylserine biosensor for in vitro, ex vivo and in vivo labelling. Dirvelyte E, Bujanauskiene D, Jankaityte E, Daugelaviciene N, Kisieliute U, Nagula I, Budvytyte R, Neniskyte U. Cell Mol Biol Lett. 2023 Jul 27;28(1):59. doi: 10.1186/s11658-023-00472-7. 10.1186/s11658-023-00472-7 PubMed 37501184