pRSFDuet-1-Cdc45
(Plasmid
#208796)
-
PurposeXenopus laevis FLAG5-His10-TEV-Cdc45
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 208796 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRSFDuet-1
- Backbone size w/o insert (bp) 3829
- Total vector size (bp) 5653
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsExpression overnight at 18°C
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCdc45
-
Alt nameCell division control protein 45
-
SpeciesX. laevis (frog)
-
Insert Size (bp)1874
-
GenBank IDNM_001088373.1 NP_001081842.1
-
Entrez Genecdc45.L (a.k.a. XELAEV_18007695mg, cdc45, cdc45l, cdc45l2, porc-pi-1)
- Promoter T7
-
Tags
/ Fusion Proteins
- FLAG (N terminal on insert)
- His
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byProf. Luca Pellegrini
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Simon AC, Sannino V, Costanzo V, Pellegrini L. Structure of human Cdc45 and implications for CMG helicase function. Nat Commun. 2016 May 18;7:11638. doi: 10.1038/ncomms11638. PMID: 27189187; PMCID: PMC4873980.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSFDuet-1-Cdc45 was a gift from Aga Gambus (Addgene plasmid # 208796 ; http://n2t.net/addgene:208796 ; RRID:Addgene_208796) -
For your References section:
The structural mechanism of dimeric DONSON in replicative helicase activation. Cvetkovic MA, Passaretti P, Butryn A, Reynolds-Winczura A, Kingsley G, Skagia A, Fernandez-Cuesta C, Poovathumkadavil D, George R, Chauhan AS, Jhujh SS, Stewart GS, Gambus A, Costa A. Mol Cell. 2023 Nov 16;83(22):4017-4031.e9. doi: 10.1016/j.molcel.2023.09.029. Epub 2023 Oct 10. 10.1016/j.molcel.2023.09.029 PubMed 37820732