Skip to main content

pRSFDuet-1-Cdc45
(Plasmid #208796)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 208796 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRSFDuet-1
  • Backbone size w/o insert (bp) 3829
  • Total vector size (bp) 5653
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Expression overnight at 18°C
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cdc45
  • Alt name
    Cell division control protein 45
  • Species
    X. laevis (frog)
  • Insert Size (bp)
    1874
  • GenBank ID
    NM_001088373.1 NP_001081842.1
  • Entrez Gene
    cdc45.L (a.k.a. XELAEV_18007695mg, cdc45, cdc45l, cdc45l2, porc-pi-1)
  • Promoter T7
  • Tags / Fusion Proteins
    • FLAG (N terminal on insert)
    • His

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Prof. Luca Pellegrini
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Simon AC, Sannino V, Costanzo V, Pellegrini L. Structure of human Cdc45 and implications for CMG helicase function. Nat Commun. 2016 May 18;7:11638. doi: 10.1038/ncomms11638. PMID: 27189187; PMCID: PMC4873980.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSFDuet-1-Cdc45 was a gift from Aga Gambus (Addgene plasmid # 208796 ; http://n2t.net/addgene:208796 ; RRID:Addgene_208796)
  • For your References section:

    The structural mechanism of dimeric DONSON in replicative helicase activation. Cvetkovic MA, Passaretti P, Butryn A, Reynolds-Winczura A, Kingsley G, Skagia A, Fernandez-Cuesta C, Poovathumkadavil D, George R, Chauhan AS, Jhujh SS, Stewart GS, Gambus A, Costa A. Mol Cell. 2023 Nov 16;83(22):4017-4031.e9. doi: 10.1016/j.molcel.2023.09.029. Epub 2023 Oct 10. 10.1016/j.molcel.2023.09.029 PubMed 37820732