pSJ107-2x
(Plasmid
#208812)
-
PurposeExpresses SoxS activation domainand gRNA targeting two copies of 107 region within the synthetic promoter in bacterial cell
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 208812 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneSynthetic backbone
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA 107-2x_mRFP
-
gRNA/shRNA sequenceCGGTGTCCTGCGGTTACCAA
-
SpeciesSynthetic
- Promoter CRISPR/dCas9-responsive synthetic promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTCTTTCGACTGAGCCTTTCG
- 3′ sequencing primer AAAACAGGAAGGCAAAATGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSJ107-2x was a gift from Marc Erhardt (Addgene plasmid # 208812 ; http://n2t.net/addgene:208812 ; RRID:Addgene_208812) -
For your References section:
A versatile regulatory toolkit of arabinose-inducible artificial transcription factors for Enterobacteriaceae. Naseri G, Raasch H, Charpentier E, Erhardt M. Commun Biol. 2023 Oct 3;6(1):1005. doi: 10.1038/s42003-023-05363-3. 10.1038/s42003-023-05363-3 PubMed 37789111