pJUB1
              
              
                (Plasmid
                
                #208813)
              
            
            
            
          - 
            PurposeExpresses arabinose-inducible JUB1-derived artificial transcription factor in bacterial cell
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 208813 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backboneSynthetic backbone
 - 
              Vector typeBacterial Expression, Synthetic Biology
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Kanamycin, 50 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert nameJUB1 TF
 - 
                    SpeciesA. thaliana (mustard weed), Synthetic
 - Promoter Arabinsoe-inducible promoter
 
Cloning Information
- Cloning method Gibson Cloning
 - 5′ sequencing primer GGGTTTAGTGTTGCCATCTA
 - 3′ sequencing primer ATGCCATAGCATTTTTATCC (Common Sequencing Primers)
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pJUB1 was a gift from Marc Erhardt (Addgene plasmid # 208813 ; http://n2t.net/addgene:208813 ; RRID:Addgene_208813) - 
                
For your References section:
A versatile regulatory toolkit of arabinose-inducible artificial transcription factors for Enterobacteriaceae. Naseri G, Raasch H, Charpentier E, Erhardt M. Commun Biol. 2023 Oct 3;6(1):1005. doi: 10.1038/s42003-023-05363-3. 10.1038/s42003-023-05363-3 PubMed 37789111