Skip to main content

pJUB2x
(Plasmid #208814)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 208814 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Synthetic backbone
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Two copies of JUB1 binding site within the synthetic promoter
  • Species
    A. thaliana (mustard weed), Synthetic
  • Promoter JUB1 TF-responsive promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TGTGGTCTCTACAGGAATTC
  • 3′ sequencing primer AGTGCAGATGAATTTCAGGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJUB2x was a gift from Marc Erhardt (Addgene plasmid # 208814 ; http://n2t.net/addgene:208814 ; RRID:Addgene_208814)
  • For your References section:

    A versatile regulatory toolkit of arabinose-inducible artificial transcription factors for Enterobacteriaceae. Naseri G, Raasch H, Charpentier E, Erhardt M. Commun Biol. 2023 Oct 3;6(1):1005. doi: 10.1038/s42003-023-05363-3. 10.1038/s42003-023-05363-3 PubMed 37789111