AAV-U6-sgLacZ-U6-sgGFP-hSyn1-mCherry
(Plasmid
#208834)
-
PurposeControl plasmid expresses mCherry under the hSyn1 promoter with sgRNAs against LacZ and GFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 208834 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerHewitt Lab
-
Modifications to backbonepX552 (Addgene #60958) was modified with additional of sgRNAs targeting LacZ and GFP with a replacement of GFP-KASH with mCherry coding sequence from Addgene #87916
-
Vector typeMammalian Expression, Bacterial Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry
-
gRNA/shRNA sequencesgLacZ / sgGFP
-
SpeciesDiscosoma
- Promoter hSyn1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site ApaI (not destroyed)
- 5′ sequencing primer CCCCGTAATGCAGAAGAAGA
- 3′ sequencing primer TTGGTCACCTTCAGCTTGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pX552 (Addgene #60958) was modified with additional of sgRNAs targeting LacZ and GFP with a replacement of GFP-KASH with mCherry coding sequence from Addgene #87916
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-U6-sgLacZ-U6-sgGFP-hSyn1-mCherry was a gift from Ben Emery (Addgene plasmid # 208834 ; http://n2t.net/addgene:208834 ; RRID:Addgene_208834) -
For your References section:
Remyelination protects neurons from DLK-mediated neurodegeneration. Duncan GJ, Ingram SD, Emberley K, Hill J, Cordano C, Abdelhak A, McCane M, Jenks JE, Jabassini N, Ananth K, Ferrara SJ, Stedelin B, Sivyer B, Aicher SA, Scanlan TS, Watkins TA, Mishra A, Nelson JW, Green AJ, Emery B. Nat Commun. 2024 Oct 23;15(1):9148. doi: 10.1038/s41467-024-53429-5. 10.1038/s41467-024-53429-5 PubMed 39443516