pQFT-lacZ
(Plasmid
#208896)
-
PurposepQFT with lacZ under control of PQJ
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 208896 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepQFT
-
Backbone manufacturerAndreas Kaczmarczyk
- Backbone size w/o insert (bp) 7500
- Total vector size (bp) 10500
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namelacZ
-
SpeciesEscherichia coli
-
Insert Size (bp)3000
-
MutationContains two silent mutations and a missense mutation resulting in a F1008L substitution that removes an internal EcoRI site
- Promoter PQJ
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI for insert, SpeI for backbone (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer 10572 (TACATATGTCAATGTACCGG) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQFT-lacZ was a gift from Urs Jenal (Addgene plasmid # 208896 ; http://n2t.net/addgene:208896 ; RRID:Addgene_208896) -
For your References section:
A Synthetic Cumate-Inducible Promoter for Graded and Homogenous Gene Expression in Pseudomonas aeruginosa. Klotz A, Kaczmarczyk A, Jenal U. Appl Environ Microbiol. 2023 May 18:e0021123. doi: 10.1128/aem.00211-23. 10.1128/aem.00211-23 PubMed 37199671