Skip to main content
Addgene

pQFT-lacZ
(Plasmid #208896)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 208896 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pQFT
  • Backbone manufacturer
    Andreas Kaczmarczyk
  • Backbone size w/o insert (bp) 7500
  • Total vector size (bp) 10500
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Tetracycline, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    lacZ
  • Species
    Escherichia coli
  • Insert Size (bp)
    3000
  • Mutation
    Contains two silent mutations and a missense mutation resulting in a F1008L substitution that removes an internal EcoRI site
  • Promoter PQJ

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI for insert, SpeI for backbone (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer 10572 (TACATATGTCAATGTACCGG)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQFT-lacZ was a gift from Urs Jenal (Addgene plasmid # 208896 ; http://n2t.net/addgene:208896 ; RRID:Addgene_208896)
  • For your References section:

    A Synthetic Cumate-Inducible Promoter for Graded and Homogenous Gene Expression in Pseudomonas aeruginosa. Klotz A, Kaczmarczyk A, Jenal U. Appl Environ Microbiol. 2023 May 18:e0021123. doi: 10.1128/aem.00211-23. 10.1128/aem.00211-23 PubMed 37199671
Commonly requested with: