Skip to main content

pNHA_OROV_NSm
(Plasmid #208935)

Ordering

This material is available to academics and nonprofits only. Orders shipped outside the U.S. may require additional regulatory approval, as well as a non-refundable export license fee of $85. Please log in to view availability.
Item Catalog # Description Quantity Price (USD)
Plasmid 208935 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCMV-HA
  • Backbone manufacturer
    Christopher A Walsh
  • Backbone size w/o insert (bp) 3800
  • Total vector size (bp) 4328
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NSm
  • Alt name
    Medium non-structural protein
  • Species
    Oropouche orthobunyavirus
  • Insert Size (bp)
    528
  • Mutation
    Deleted 949 bp from 5' end (Gn), deleted 2911 bp from 3' end (Gc) and inserted start codon at 5' end so only NSm expressed
  • GenBank ID
    NC_005775.1
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CAGGAAACAGCTATGAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    OROV genes were cloned from plasmids provided by Prof. Richard Elliott, University of Glasgow.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNHA_OROV_NSm was a gift from Gerald Barry (Addgene plasmid # 208935 ; http://n2t.net/addgene:208935 ; RRID:Addgene_208935)