pCHA_OROV_NSs
(Plasmid
#208939)
-
PurposeExpresses C-terminally HA-tagged Oropouche orthobunyavirus NSs protein from CMV promoter in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 208939 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneV27 pLPS-3' HA - Acceptor
-
Backbone manufacturerTony Pawson
- Backbone size w/o insert (bp) 4195
- Total vector size (bp) 4468
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNSs
-
Alt nameSmall non-structural protein
-
SpeciesOropouche orthobunyavirus
-
Insert Size (bp)273
-
MutationDeleted 66 bp from 5' end and deleted 415 bp from 3' end so only NSs expressed
-
GenBank IDNC_005777.1
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byOROV genes were cloned from plasmids provided by Prof. Richard Elliott, University of Glasgow.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCHA_OROV_NSs was a gift from Gerald Barry (Addgene plasmid # 208939 ; http://n2t.net/addgene:208939 ; RRID:Addgene_208939)