pLCHKOv3-mCherry-intergenic-As
(Plasmid
#209037)
-
PurposeLentiviral vector expressing mCherry along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectively
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 209037 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLCHKOv3-Cherry
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin ; mCherry
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
-
gRNA/shRNA sequenceTGACTCTTCCATAGCGATTGGTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTAATTTCTACTCTTGTAGATAGAATTGAGTTAGTCAATCCTCT
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLCHKOv3-mCherry-intergenic-As was a gift from Thomas Gonatopoulos-Pournatzis (Addgene plasmid # 209037 ; http://n2t.net/addgene:209037 ; RRID:Addgene_209037) -
For your References section:
Genome-scale exon perturbation screens uncover exons critical for cell fitness. Xiao MS, Damodaran AP, Kumari B, Dickson E, Xing K, On TA, Parab N, King HE, Perez AR, Guiblet WM, Duncan G, Che A, Chari R, Andresson T, Vidigal JA, Weatheritt RJ, Aregger M, Gonatopoulos-Pournatzis T. Mol Cell. 2024 Jul 11;84(13):2553-2572.e19. doi: 10.1016/j.molcel.2024.05.024. Epub 2024 Jun 24. 10.1016/j.molcel.2024.05.024 PubMed 38917794