pENTR223-CMV-Cre-U6-sgNotch1#1-U6-sgRb1-U6-sgTrp53-U6-sgRbl2
(Plasmid
#209068)
-
PurposeEntry vector that encodes sgRNAs against mouse Notch1, Rb1, Trp53, Rbl2, and CMV Cre recombinase.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 209068 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDONR223
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5005
- Total vector size (bp) 6119
-
Vector typeGateway vector to be used for LR reaction
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNAs targeting Notch1, Rb1, Trp53, Rbl2 and Cre recombinase
-
gRNA/shRNA sequenceCACCGCGAGCGCGGGCAGCAGCGTT
-
SpeciesM. musculus (mouse)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Esp3i (unknown if destroyed)
- 3′ cloning site Esp3i (unknown if destroyed)
- 5′ sequencing primer M13F
- 3′ sequencing primer M13R
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENTR223-CMV-Cre-U6-sgNotch1#1-U6-sgRb1-U6-sgTrp53-U6-sgRbl2 was a gift from Matthew Oser (Addgene plasmid # 209068 ; http://n2t.net/addgene:209068 ; RRID:Addgene_209068) -
For your References section:
Plasticity in the Absence of NOTCH Uncovers a RUNX2-Dependent Pathway in Small Cell Lung Cancer. Hong D, Knelson EH, Li Y, Durmaz YT, Gao W, Walton E, Vajdi A, Thai T, Sticco-Ivins M, Sabet AH, Jones KL, Schinzel AC, Bronson RT, Nguyen QD, Tolstorukov MY, Vivero M, Signoretti S, Barbie DA, Oser MG. Cancer Res. 2022 Jan 15;82(2):248-263. doi: 10.1158/0008-5472.CAN-21-1991. Epub 2021 Nov 22. 10.1158/0008-5472.CAN-21-1991 PubMed 34810201