pAAV-CMV-FLEX-SaCas9-U6-sgCnr1
(Plasmid
#209196)
-
PurposeMutagenesis of Cnr1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 209196 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAAV-FLEX-SaCas9-U6-sgRNA
-
Backbone manufacturerLarry Zweifel (Addgene plasmid # 124844)
-
Vector typeMouse Targeting, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCnr1
-
gRNA/shRNA sequenceAAGGCCTGCATCGGAGACTGC
-
SpeciesM. musculus (mouse)
-
Entrez GeneCnr1 (a.k.a. CB-R, CB1, CB1A, CB1B, CB1R)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CMV-FLEX-SaCas9-U6-sgCnr1 was a gift from Larry Zweifel (Addgene plasmid # 209196 ; http://n2t.net/addgene:209196 ; RRID:Addgene_209196) -
For your References section:
A cortico-amygdala neural substrate for endocannabinoid modulation of fear extinction. Gunduz-Cinar O, Castillo LI, Xia M, Van Leer E, Brockway ET, Pollack GA, Yasmin F, Bukalo O, Limoges A, Oreizi-Esfahani S, Kondev V, Baldi R, Dong A, Harvey-White J, Cinar R, Kunos G, Li Y, Zweifel LS, Patel S, Holmes A. Neuron. 2023 Jul 19:S0896-6273(23)00482-8. doi: 10.1016/j.neuron.2023.06.023. 10.1016/j.neuron.2023.06.023 PubMed 37480845