pAAV-CMV-FLEX-SaCas9-U6-sgKcnma1
(Plasmid
#209199)
-
PurposeMutagenesis of Kcnma1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 209199 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV-FLEX-SaCas9-U6-sgRNA
-
Backbone manufacturerLarry Zweifel (Addgene plasmid # 124844)
-
Vector typeMouse Targeting, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKcnma1
-
gRNA/shRNA sequenceGTCTAGGCTGAGATGGTTCGC
-
SpeciesM. musculus (mouse)
-
Entrez GeneKcnma1 (a.k.a. 5730414M22Rik, BKCA alpha, BKCa, KCa1.1, MaxiK, Slo, Slo1, k(VCA)alpha, mSlo, mSlo1, slo-alpha)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CMV-FLEX-SaCas9-U6-sgKcnma1 was a gift from Larry Zweifel (Addgene plasmid # 209199 ; http://n2t.net/addgene:209199 ; RRID:Addgene_209199) -
For your References section:
Temporal scaling of dopamine neuron firing and dopamine release by distinct ion channels shape behavior. Juarez B, Kong MS, Jo YS, Elum JE, Yee JX, Ng-Evans S, Cline M, Hunker AC, Quinlan MA, Baird MA, Elerding AJ, Johnson M, Ban D, Mendez A, Goodwin NL, Soden ME, Zweifel LS. Sci Adv. 2023 Aug 11;9(32):eadg8869. doi: 10.1126/sciadv.adg8869. Epub 2023 Aug 11. 10.1126/sciadv.adg8869 PubMed 37566654