Skip to main content

p3015b
(Plasmid #209317)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 209317 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    vpL3004
  • Total vector size (bp) 7795
  • Modifications to backbone
    Added sgRNA template and protospacer cloning site; added mCherry fluorescent marker
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Erythromycin, 300 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Group B Streptococcus-compatible single guide RNA
  • Alt name
    GBS sgRNA
  • gRNA/shRNA sequence
    None/flexible insertion site
  • Species
    Streptococcus agalactiae
  • GenBank ID
    NZ_CP012480.1
  • Promoter Xyl/tet promoter that is constitutively active

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAGTAATCTTTGTGCGGTTTAAC
  • 3′ sequencing primer TACCGCCTTTGAGTGAGCTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p3015b was a gift from Thomas Hooven (Addgene plasmid # 209317 ; http://n2t.net/addgene:209317 ; RRID:Addgene_209317)
  • For your References section:

    Group B Streptococcus Cas9 variants provide insight into programmable gene repression and CRISPR-Cas transcriptional effects. Gopalakrishna KP, Hillebrand GH, Bhavana VH, Elder JL, D'Mello A, Tettelin H, Hooven TA. Commun Biol. 2023 Jun 9;6(1):620. doi: 10.1038/s42003-023-04994-w. 10.1038/s42003-023-04994-w PubMed 37296208