p3015b
(Plasmid
#209317)
-
PurposeExpresses a sgRNA template with a protospacer cloning site flanked by BsaI restriction sites for easy insertion of a targeting cassette.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 209317 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonevpL3004
- Total vector size (bp) 7795
-
Modifications to backboneAdded sgRNA template and protospacer cloning site; added mCherry fluorescent marker
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Erythromycin, 300 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGroup B Streptococcus-compatible single guide RNA
-
Alt nameGBS sgRNA
-
gRNA/shRNA sequenceNone/flexible insertion site
-
SpeciesStreptococcus agalactiae
-
GenBank IDNZ_CP012480.1
- Promoter Xyl/tet promoter that is constitutively active
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGTAATCTTTGTGCGGTTTAAC
- 3′ sequencing primer TACCGCCTTTGAGTGAGCTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p3015b was a gift from Thomas Hooven (Addgene plasmid # 209317 ; http://n2t.net/addgene:209317 ; RRID:Addgene_209317) -
For your References section:
Group B Streptococcus Cas9 variants provide insight into programmable gene repression and CRISPR-Cas transcriptional effects. Gopalakrishna KP, Hillebrand GH, Bhavana VH, Elder JL, D'Mello A, Tettelin H, Hooven TA. Commun Biol. 2023 Jun 9;6(1):620. doi: 10.1038/s42003-023-04994-w. 10.1038/s42003-023-04994-w PubMed 37296208