Skip to main content

AAV-EGFP-APOBEC1-YTHmut
(Plasmid #209320)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 209320 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    CAG-EGFP
  • Backbone manufacturer
    Gift from Minmin Luo's lab
  • Backbone size w/o insert (bp) 5436
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    APOBEC1-YTHmut-HA
  • Species
    H. sapiens (human), R. norvegicus (rat)
  • Insert Size (bp)
    1332
  • Mutation
    YTH domain lacks AA 385-409 comprising the m6A-binding region
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer EGFP-C_seq_F: catggtcctgctggagttcgtg
  • 3′ sequencing primer WPRE-seq_R:cagcgtatccacatagcgta
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Kate Meyer (Addgene plasmid # 131637)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

5' cloning sites:EGFP_P2A_clone_F: gcatggacgagctgtacaaggccactaacttctccctP2A_clone_F: gccactaacttctccctgttgaaacaagcaggggatgtcgaagagaatcccgggccaP2A_APOBEC1_clone_F: gaagagaatcccgggccaatgagctcagagactggccc3' cloning site:WPRE-HindIII-SD-HA-clone-R: tccagaggttgattatcgataagcttttaggcgtagtcgggcacgtcgt

Please visit https://www.biorxiv.org/content/10.1101/2023.12.06.570314v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-EGFP-APOBEC1-YTHmut was a gift from Magdalena Koziol (Addgene plasmid # 209320 ; http://n2t.net/addgene:209320 ; RRID:Addgene_209320)
  • For your References section:

    Single-cell discovery of m(6)A RNA modifications in the hippocampus. Feng S, Tellaetxe-Abete M, Zhang Y, Peng Y, Zhou H, Dong M, Larrea E, Xue L, Zhang L, Koziol MJ. Genome Res. 2024 Jul 23;34(6):822-836. doi: 10.1101/gr.278424.123. 10.1101/gr.278424.123 PubMed 39009472