AAV-EGFP-APOBEC1-YTHmut
(Plasmid
#209320)
-
PurposeAAV packaging vector containing a EGFP-P2A expression cassette, APOBEC1-YTHmut cassette.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 209320 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCAG-EGFP
-
Backbone manufacturerGift from Minmin Luo's lab
- Backbone size w/o insert (bp) 5436
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameAPOBEC1-YTHmut-HA
-
SpeciesH. sapiens (human), R. norvegicus (rat)
-
Insert Size (bp)1332
-
MutationYTH domain lacks AA 385-409 comprising the m6A-binding region
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer EGFP-C_seq_F: catggtcctgctggagttcgtg
- 3′ sequencing primer WPRE-seq_R:cagcgtatccacatagcgta
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byKate Meyer (Addgene plasmid # 131637)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
5' cloning sites:EGFP_P2A_clone_F: gcatggacgagctgtacaaggccactaacttctccctP2A_clone_F: gccactaacttctccctgttgaaacaagcaggggatgtcgaagagaatcccgggccaP2A_APOBEC1_clone_F: gaagagaatcccgggccaatgagctcagagactggccc3' cloning site:WPRE-HindIII-SD-HA-clone-R: tccagaggttgattatcgataagcttttaggcgtagtcgggcacgtcgt
Please visit https://www.biorxiv.org/content/10.1101/2023.12.06.570314v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-EGFP-APOBEC1-YTHmut was a gift from Magdalena Koziol (Addgene plasmid # 209320 ; http://n2t.net/addgene:209320 ; RRID:Addgene_209320) -
For your References section:
Single-cell discovery of m(6)A RNA modifications in the hippocampus. Feng S, Tellaetxe-Abete M, Zhang Y, Peng Y, Zhou H, Dong M, Larrea E, Xue L, Zhang L, Koziol MJ. Genome Res. 2024 Jul 23;34(6):822-836. doi: 10.1101/gr.278424.123. 10.1101/gr.278424.123 PubMed 39009472