pBWB507
(Plasmid
#209325)
-
Purposep15A-tetR-tet-ME-RBS-mRFP-ME-U1-Barcode-U2-dbI terminator-oriT-Cm. Plasmid backbone for fragment expression.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 209325 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneJBEI-00059
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemRFP
- Promoter tet
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcgagtttacgggttgttaaac
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBWB507 was a gift from Adam Arkin (Addgene plasmid # 209325 ; http://n2t.net/addgene:209325 ; RRID:Addgene_209325) -
For your References section:
High-throughput protein characterization by complementation using DNA barcoded fragment libraries. Biggs BW, Price MN, Lai D, Escobedo J, Fortanel Y, Huang YY, Kim K, Trotter VV, Kuehl JV, Lui LM, Chakraborty R, Deutschbauer AM, Arkin AP. Mol Syst Biol. 2024 Oct 7. doi: 10.1038/s44320-024-00068-z. 10.1038/s44320-024-00068-z PubMed 39375541