Skip to main content

LMPd Amt OXCT1
(Plasmid #209407)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 209407 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    LMPd Amt
  • Backbone manufacturer
    Chen et al. 2014
  • Vector type
    Retroviral
  • Selectable markers
    Ametrine

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Oxct1 shRNA
  • gRNA/shRNA sequence
    TGCTGTTGACAGTGAGCGCCGGAAGGATGTCAGTAATCAATAGTGAAGCCACAGATGTATTGATTACTGACATCCTTCCGTTGCCTACTGCCTCGGA
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Oxct1 (a.k.a. 2610008O03Rik, Oxct, Oxct2a, SCOT, Scot-s)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer cgatcctccctttatccagcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LMPd Amt OXCT1 was a gift from Russell Jones (Addgene plasmid # 209407 ; http://n2t.net/addgene:209407 ; RRID:Addgene_209407)
  • For your References section:

    Ketolysis drives CD8(+) T cell effector function through effects on histone acetylation. Luda KM, Longo J, Kitchen-Goosen SM, Duimstra LR, Ma EH, Watson MJ, Oswald BM, Fu Z, Madaj Z, Kupai A, Dickson BM, DeCamp LM, Dahabieh MS, Compton SE, Teis R, Kaymak I, Lau KH, Kelly DP, Puchalska P, Williams KS, Krawczyk CM, Levesque D, Boisvert FM, Sheldon RD, Rothbart SB, Crawford PA, Jones RG. Immunity. 2023 Sep 12;56(9):2021-2035.e8. doi: 10.1016/j.immuni.2023.07.002. Epub 2023 Jul 28. 10.1016/j.immuni.2023.07.002 PubMed 37516105