Skip to main content

LMPd Amt LDHA
(Plasmid #209408)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 209408 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    LMPd Amt
  • Backbone manufacturer
    Chen et al. 2014
  • Vector type
    Retroviral
  • Selectable markers
    Ametrine

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LdhA shRNA
  • gRNA/shRNA sequence
    TGCTGTTGACAGTGAGCGAACTCAATTTGGTCCAGCGAAATAGTGAAGCCACAGATGTATTTCGCTGGACCAAATTGAGTCTGCCTACTGCCTCGGA
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Ldha (a.k.a. Ldh1, Ldhm, l7R2)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer cgatcctccctttatccagcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LMPd Amt LDHA was a gift from Russell Jones (Addgene plasmid # 209408 ; http://n2t.net/addgene:209408 ; RRID:Addgene_209408)
  • For your References section:

    Carbon source availability drives nutrient utilization in CD8(+) T cells. Kaymak I, Luda KM, Duimstra LR, Ma EH, Longo J, Dahabieh MS, Faubert B, Oswald BM, Watson MJ, Kitchen-Goosen SM, DeCamp LM, Compton SE, Fu Z, DeBerardinis RJ, Williams KS, Sheldon RD, Jones RG. Cell Metab. 2022 Sep 6;34(9):1298-1311.e6. doi: 10.1016/j.cmet.2022.07.012. Epub 2022 Aug 17. 10.1016/j.cmet.2022.07.012 PubMed 35981545