2015-N iFAST
(Plasmid
#209415)
-
PurposeiFAST expression plasmid using MET3p
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 209415 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbone2015-N
- Backbone size w/o insert (bp) 8544
- Total vector size (bp) 8921
-
Vector typeYeast Expression
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameiFAST
-
SpeciesSynthetic
-
Insert Size (bp)376
- Promoter MET3
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AATACCCTCCCCAGAAAACTATGGAACATGTTGCCTTTG
- 3′ sequencing primer CACCAGAACCTCCACCTCCGTTAAACCCTTTTGACAAACAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
2015-N iFAST was a gift from Patrick Van Dijck (Addgene plasmid # 209415 ; http://n2t.net/addgene:209415 ; RRID:Addgene_209415) -
For your References section:
A multi-colour fluorogenic tag and its application in Candida albicans. Devos J, Van Dijck P, Van Genechten W. Microbiology (Reading). 2024 Mar;170(3). doi: 10.1099/mic.0.001451. 10.1099/mic.0.001451 PubMed 38535895