pCRISPR-cBEST-v2-kasOP*
(Plasmid
#209447)
-
Purposeimproved pCRISPR-cBEST plasmid with optimized sgRNA cloning site and expression of the sgRNA from the kasOP* promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 209447 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGM1190
-
Vector typeCRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Apramycin, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsmaintenance in streptomycetes at 30 C. Temperature sensitive pSG5 replicon, replication only below 37 C.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCodon optimized APOBEC1-nCas9-UGI fusion protein
-
Alt nameCytosine base editor
-
SpeciesSynthetic
-
Insert Size (bp)5100
- Promoter PtipA; sgRNA expression from kasOP* promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAacatgctgtgcggtgttg
- 3′ sequencing primer TGCTGACCGGATCAGCAGTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPR-cBEST-v2-kasOP* was a gift from Tilmann Weber (Addgene plasmid # 209447 ; http://n2t.net/addgene:209447 ; RRID:Addgene_209447) -
For your References section:
Biosynthesis of the Azoxy Compound Azodyrecin from Streptomyces mirabilis P8-A2. Maleckis M, Wibowo M, Gren T, Jarmusch SA, Sterndorff EB, Booth T, Henriksen NNSE, Whitford CM, Jiang X, Jorgensen TS, Ding L, Weber T. ACS Chem Biol. 2024 Feb 10. doi: 10.1021/acschembio.3c00632. 10.1021/acschembio.3c00632 PubMed 38340355